Panida L's Blog



Assignment-3

Phylogenetic tree construction by using BioEdit program

Common ancestors of organisms can be investigated by means of phylogenetic analysis. Mitochondrial cytochrome b nucleotide sequence showing below is found to be of a dinosaur that lived 80 million years ago:

cccttctattattcattctcattctattcgttattcttgtactccacacatccaaacaac aaagcataatattccacccattgagtccattcctatcctgattcttagtccccgaacctt
ttacactcacatg

Phylogenetic tree of the dinosaur cytochrome b is constructed to find which organism(s) that share common ancestors with it.

1. Retrieve cytochrome b nucleotide sequences from Entrez Nucleotide database http://www.ncbi.nlm.nih.gov/sites/entrez. For each organism, choose nucleotide and add the organism scientific name along with “AND cytochrome b”–e.g. Homo sapiens AND cytochrome b. Then, the result page will show up and click on RefSeq tab as following:

Click on CYTB, which is an abbrevation of cytochrome b, under search in Gene section. The following page will appear.

Scroll down to “Genomic regions, transcripts, and products”. Click on the NCBI reference sequence number, NC_012920.1, and choose “FASTA” from Nucleotide link. The nucleotide sequence in FASTA format will appear and save it as text file. The organisms used in phylogenetic tree construction are shown with their NCBI accession number:

Human: Homo sapiens, NC_012920.1
Dog: Canis lupus, NC_002008.1
Rabbit: Oryctolagus cuniculus, NC_001913.1
Rhinoceros: Rhinoceros unicornis, NC_001779.1
Dugong: Dugong dugon, NC_003314.1
Mouse: Mus musculus, NC_010339.1
Whale: Balaenoptera edeni, NC_007938.1
Bovine: Bos taurus, NC_006853.1
Sicklebill: Epimachus fastuosus, GQ334244.1
Chicken: Gallus gallus, NC_001323.1
Magpie: Pica hudsonia, AY030114.1
Frog: Rana plancyi, NC_009264.1

The nucleotide search step can be shortened by using “CYTB” as a keyword instead of the full name “cytochrome b”, which will give several results as it is not a specific name–e.i. there can be cytochrome b reductase, etc. Then, go to RefSeq tab and the target sequence will be listed.

All of the nucleotide sequences of these organisms in FASTA format are ordered in the same text file as shown below. Nucleotide sequence of dinosaur cytochrome b is also added in this text file.

2. Open BioEdit, which can be downloaded from http://www.mbio.ncsu.edu/BioEdit/bioedit.html. Start alignment by going to the menu bar and choose ”File > New Alignment”

A new alignment page will appear.

3. Import nucleotide sequences in FASTA format by “File>Import>Sequence alignment file” on the menu bar.

The nucleotide sequences will appear on the right panel and the names of the sequence will appear on the left panel.

4. Align the sequences by highlighting all the names of the sequences. Then, choose “Accessory Application > ClustalW Multiple Alignment”

A popup window will show up and click on “RunClustalW” button.

The program will run in DOS window.

The alignment will be shown in a new window.

5. Calculate distance among these nucleotide sequences by selecting all sequences. Then, choose “Accessory Application>DNAmlk DNA Maximum Likelihood program with molecular clock”

A small window of the program will appear. Click on “Run Application”.

The distance among these organisms will appear

Save it as text file. The tree is shown as following

6. View the phylogram by using TreeViewX, which can be downloaded from http://darwin.zoology.gla.ac.uk/~rpage/treeviewx/download.html

The program will display the graphic tree, and it can be set to be view as slanted cladogram, rectangular cladogram, or phylogram.

Open the program, go to “File>New…” on the menu bar.

Open the text file of the tree from BioEdit by “File>Open…” and the graphic view of the tree will appear as following. The type of tree view can be chosen on “Trees” on the menu bar.

From this phylogram, there are 2 major groups of animals as there are 2 clades beginning on the left. Magpie and Sicklebill are closely related since both of them are passerines, while Chicken is categorized in this group as all of them are birds (Class Aves). They share ancestor with Frog, which is in another class of amphibian. The length of the clade line represents how closed they are, and Frog is very far from these birds. On the next group, Human and dinosaur are categorized in the same group even though the distance between them is rather far. Based on the phylogram, the dinosaur is closely related to human. Whale is closed to bovine and rhinoceros. Dog and mouse are closely related.


Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Connecting to %s

Follow

Get every new post delivered to your Inbox.