Panida L's Blog



Assignment 5

Please use the bioinformatics tools to design these following items;

1. The real-time PCR primer and probe set(s) which can be used to distinguish between 2009 Swine-Origin Influenza A (H1N1)from other influenza subtypes.
Please also describe what are gene(s)/region(s) that you choose? And give us the reason why?

To distinguish 2009 swine-originated influenza A (H1N1) from other subtypes, real time PCR is a promising approach if a specific region is chosen. The virus is characterised by haemagglutinin 1 and neuraminidase 1 that present on the envelope of the virus. The region(s) of 2009 swine-originated that differs from other subtypes is determined by means of alignment in order to separate it from other subtypes.

Retrieve the hemagglutinin (HA) mRNA and amino acid sequence of swine influenza from GenBank (http://www.ncbi.nlm.nih.gov). Search nucleotide for H1N1 AND HA. Amino acid sequence is included after “translation” heading. The nucleotide sequences of HA gene are available from many countries. HA nucleotide sequences of H1N1 influenza that is not a swine-orginated are retrieved to compare with HA of swine-originated influenza.  

GenBank accession number of HA:
NWS: U08903.1
Alberta: U47310.1
Ws: U08904.1
Swine influenza from Rio de Janeiro: CY054281.1
Swine influenza from Nebraska: S67220.1

Amino acid alignment of these 5 strains of H1N1 is done on ClustalW program (http://www.ebi.ac.uk/clustalw). Paste the sequences in FASTA format and run the program.

Asterisk represents the amino acid that is found in all strains. The region with asterisk will be ignored, while the region of amino acid sequences that the 2 swine influenza are similar but different from the rest are considered.  This region will be subsequently used for identification of swine-originated influenza. The nucleotide alignment is also done to find the chosen region from amino acid alignment, which is the position 201-254, that corresponds to nucleotide sequence.

 The chosen region of nucleotide is 623-761. This region is used for real time PCR primer and probe design in Primer3 program (http://frodo.wi.mit.edu/primer3). Paste the sequence of this region onto the program. The checkbox of Pick left primer, right primer and hybidization probe are chosen to design forward and reverse primers and the single probe.

 The parameters of primers are set as following:

Product size ranges: 50-90, 80-120 bp

Primer size: min 19 bp, opt 20 bp, max 23 bp

Primer Tm: min 60 oC, opt 64 oC, 68 oC

Primer CG%: min 35, max 65

The parameters of probe (Hyb Oligo) is as following:

Hyb Oligo excluded region: 47,4 98,8 (these regions will not be considered for the probe since they are conserved region in all strains)

Hyb Oligo size: min 20 bp, opt 23 bp, max 26 bp

Hyb Oligo Tm: min 68 oC, opt 70 oC, max 70 oC

Hyb Oligo GC%: min 20, opt 60, max 80

Then, click on “Pick primers”

Forward primer: TCAACAAGCTCTCTACCAGAACG, Tm 60.95 oC, %GC 47.83 
Reverse primer: TCGTTGCTATTTCTGGCTTGAAC, Tm 62.75 oC, %GC 43.48 

Probe: TGCCTATGTTTTTGTGGGGTCATCA, Tm 68.29 oC, %GC 44.00

The start position is 651 and ends at position 762 (corresponding to the position of the HA gene). The probe binds from position 678-703. The product size is 89 bp.
 2. The conventional PCR and sequencing primer set which can be used to identify oseltamivir resistance associated NA gene mutations: N1: H274Y

Sequencing of NA gene to identify mutation that leads to oseltamivir resistance in H1N1 virus

The nucleotide sequence of neuraminidase is retrieved from GenBank. The accession number of swine-originated influenza neuraminidase gene is GU371257.1, while that of oseltamivir resistance is GU371269.1. These sequences are aligned in order to determined the mutate region by using ClustalW program (http://www.ebi.ac.uk/Tools/clustalw2/index.html).

The nucleotide sequences are given in FASTA format. Click on “Run”. The alignment will appear.

Neuraminidase 1 protein has a nucleotide transversion of cytosine at position 827 in segment 6 to thyrimidine that leads to amino acid substitution of histidine to tyrosine. To identify oseltamivir resistance, this position should be determined.

Sequencing of this mutation can be achieved by using primers covering around this region. Nucleotide sequence of wild-type NA gene is applied to Primer3 program (http://frodo.wi.mit.edu/primer3).

On checkbox, choose “Pick left primer” and “Pick right primer”. The parameters are set as following:

- Targets (to indicate the nucleotides that we want to include in the product, in this case the mutation is at position 827): 825,5 (starts to include at position 825 for 5 bases)

- Product size ranges: 150-250, 100-300 bp

- General primer picking conditions:
 Primer size: min 20 bp, opt 23, max 25
 Primer Tm: min 55 oC, opt 60 oC, max 75 oC
 Primer GC%: min 40, opt 50, max 60

Then, click on “Pick primers”. The result will show up

Sequencing primers are obtain as following:

The forward primer: CAGGCCTCATACAAGATCTTCAG, Tm 60.27 oC, %GC   47.83 
The reverse primer: CCAGATTCTGATTGAAAGACACC, Tm 59.99 oC, %GC   43.48

 The alignment of primers and the sequence show that the start position is 753 and end is 936. The product size is 184 bp. Asterisks show the included nucleotide that the mutate nucleotide is at position 827 or position 74 in the sequencing.

Conventional PCR of NA 1 gene

The parameters of conventional PCR primers are different from sequencing primers.

- Product size ranges: 250-300 300-400 400-500 bp

- General primer picking conditions:
 Primer size: min 18 bp, opt 20 bp, max 22  bp
 Primer Tm: min 52 oC, opt 55 oC, max 58 oC
 Primer GC%: min 40, opt 50, max 60

Forward primer: GCTTTACTGTAATGACCGATG, 21mers, Tm 55.02 oC, %GC 42.86

Reverse primer: TGCCTGTCTTATCATTAGGG, 20 mers, Tm 55.35 oC, %GC   45.00 

The product starts from position 718 - 1005 of NA gene. Product size: 288 bp

Advertisement

Leave a Reply

Fill in your details below or click an icon to log in:

WordPress.com Logo

You are commenting using your WordPress.com account. Log Out / Change )

Twitter picture

You are commenting using your Twitter account. Log Out / Change )

Facebook photo

You are commenting using your Facebook account. Log Out / Change )

Connecting to %s

Follow

Get every new post delivered to your Inbox.